Importantly, resistance is overcome by cMET targeting agents. hepatic stellate cells. We further determined that activation of PI3K// isoforms mediates the resistance to MEK inhibitors by HGF. Combination of LY2801653 with trametinib decreases AKT phosphorylation and promotes pro-apoptotic PARP cleavage in metastatic UM explants. Together, our data support the notion that selectively blocking cMET signaling or PI3K ANK3 isoforms in metastatic UM may break the intrinsic resistance to MEK inhibitors provided by factors from stromal cells in liver. explants. Our data show that down-regulation in the BH3-only proteins, Bim-EL and Bmf, contribute to HGF-mediated protective effect in metastatic UM cells. Clinical grade cMET targeting agents effectively overcome the resistance provided by exogenous HGF as well as factors derived from hepatic stellate cells. Combined inhibition of cMET and MEK1/2 enhances apoptotic signal in cell lines and an explant model of metastatic UM. Together, these data provide a pre-clinical basis for combinational therapies targeting mutant Gq/11 signaling and signaling initiated by factors from tumor microenvironment in advanced-stage UM patients. Materials and Methods Cell culture UM001 and UM004 cells were derived from liver and orbital metastases of human UM, respectively; both harbor GNAQ Q209L mutations (20, 24). UM001 cells were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated FBS, 10% non-essential amino acids, 2 mM L-glutamine and 10 mM Hepes buffer. UM004 cells were maintained in MEM medium containing 10% heat-inactivated FBS and 2 mM L-glutamine. LX-2 human hepatic stellate cell line was purchased from EMD Millipore (Billerica, MA) and cultured in DMEM medium containing 2% FBS and 2 mM L-glutamine according to manufacturers protocol. Human hepatic stellate cells (HHSteC) were cultured in basal medium, 2% FBS and 1% stellate cell growth supplement according to manufacturers protocol (ScienCell Research Laboratories. Carlsbad, CA). HHSteC conditioned medium is collected from HHSteC cultures immediately before sub-culture. Medium conditioned by early passage ( 6 passages) HHSteC cultures was used for functional co-culture experiments with UM001 and UM004 cells. Cell line validation UM001 and UM004 cells were confirmed as harboring GNAQ mutations as determined by Sanger DNA sequencing. UM001 and UM004 cells were analyzed by STR analysis on January 15th, 2015; The UM001 and UM004 profiles were unique, although the latter had a 94% match with 3 changed alleles to MDA-MB-330 cells on the DSMZ resource. Inhibitors, growth factors and function-blocking antibodies Trametinib (GSK1120212), MK2206 (PubChem compound database (CID, 24964624)), GDC0032 (25), TGX221 (26), BYL710 (25) and IPI145 (25) were purchased from Selleck Chemicals (Houston, TX). Recombinant human HGF was purchased from PeproTech (Rocky Hill, NJ) and used at 10 ng/ml based on our previous studies (20). The neutralizing and internalizing anti-cMET antibody, LY2875358, and the cMET/RON inhibitor, LY2801653 (27), were provided by Eli Lilly and Company (Indianapolis, IN). Short-interfering RNA (siRNA) and transfection UM004 cells (3 105) were seeded in 6-well plates overnight before transfection with chemically synthesized siRNAs at a final concentration of 25 nM using Lipofectamine? RNAiMAX (Invitrogen, Carlsbad, CA) as previously described (28). Bim-EL specific siRNAs (GACCGAGAAGGUAGACAAUUGTT and CAAUUGUCUACCUUCUCGGUCTT) were purchased from Cell Signaling Technology (Danvers, MA). Bmf specific siRNA (GAGUAACAGAUAACGAUUA) was purchased from Dharmacon Inc. (Lafayette, CO). A Gadobutrol non-targeting siRNA (UAGCGACUAAACACAUCAAUU) was used as a control. Western blotting Cells were washed in cold PBS Gadobutrol and lysed directly in Laemmli sample buffer. Lysates were resolved by SDS polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. Membranes were blocked with 1% BSA and incubated with indicated primary antibodies overnight at 4C. Proteins were detected using the horseradish peroxidase-conjugated secondary antibodies followed by development using chemiluminescence substrate (Pierce, Rockford, IL). The following primary antibodies were used: Gadobutrol ERK2 (D-2), Cyclin A and Noxa from Santa Cruz Biotech. Inc. (Santa Cruz, CA); Bcl-2, Bcl-xl, Mcl-1, Bax, Bad, Bid, Gadobutrol Puma, cleaved caspase 3, cleaved PARP, RB, phospho-RB (S780), cMET, phospho-cMET Y1234/1235 (D26), phospho-cMET Y1349, AKT, phospho-AKT T308 (C31E5E), phospho-AKT S473 (D9E), phospho-ERK1/2 (D13.14.4E), Stat3, phospho-Stat3 Y705, p110-PI3K, p110-PI3K and p110-PI3K from Cell Signaling Tech; cyclin D1 and Bcl-w from BD Pharmingen, p110-PI3K, -SMA and FAP from Abcam (Cambridge, MA); Bim-EL and BMF from Enzo.